X
تبلیغات
کلبه زیست شناسی

 

 1- ماده ی ژنتیک در تک سلولی ها و پر سلولی ها DNA می باشد. DNA باکتری مولکول بسته یا حلقوی (دو انتهای آن آزاد نیست) است که به غشای پلاسمایی متصل است. تقسیم دو تایی نوعی تولید مثل غیر جنسی است که به تولید زاده های یکسان می انجامد. در تولید مثل غیر جنسی فقط یک والد شرکت دارد.

2- تقسیم دوتایی در باکتری ها: پس از همانند سازی DNA با اضافه شدن غشای سلولی جدید به نقطه ای از غشا که بین دو مولکول DNA قرار دارد انجام می گیرد و غشا به سمت داخل فرو می رود و هم زمان با آن دیواره ی سلولی تشکیل می شود به این ترتیب دو سلول تشکیل می شود که یکی از دو نسخه ی DNA را دارد.

3- در سلول های یوکاریوتی بخش عمده ی DNA در درون هسته وجود دارد اما در دو اندامک سیتوپلاسمی، میتوکندری و کلروپلاست نیز DNA وجود دارد که حلقوی است. دو کروماتید در محلی به نام سانترومر به هم متصل می شوند که به آنها کروماتید های خواهری گفته می شود که در واقع یکی از این دو به تازگی از روی کروماتید دیگر همانند سازی شده. کروموزوم های تک کروماتیدی(هاپلوئید) را با علامت n و دو کروماتیدی (دیپلوئید) را با علامت 2n نشان می دهند. کروماتید های خواهری در محل سانترومر به هم متصل می مانند تا اینکه در مراحل تقسیم سلولی (در میتوز در مرحله آنافاز و در میوز در مرحله آنافاز میوز 2 )

4- برای همانند سازی DNA لازم است تا این مولکول ها فشرده شوند، این فشرده شدن بوسیله ی گروهی از پروتئین ها به نام هیستون ها انجام می شود که DNA در مناطقی دو دور به دور هشت مولکول هیستون می پیچد. به این ترتیب ساختاری را پدید می آورد که نوکلئوزوم نام دارد. یک مثال: اگر در قسمتی از مولکول DNA  که شامل 96000  مولکول هیستون است، چند ساختار نوکلئوزوم وجود دارد؟12000=8÷96000

5- حاصل لقاح اسپرم(n کروموزوم یعنی هاپلوئید و دارای 23 کروموزوم تک کروماتیدی است) و تخمک (n کروموزوم ، هاپلوئید و دارای 23 کروموزوم تک کروماتیدی است ) که سلول تخم یا زیگوت (2n و دیپلوئید است که 46 کروموزوم دارد) بوجود می آید

6- تعداد کروموزوم های جاندارانی که در کتاب ذکر شده مهم است مهمترین آنها: شامپانزه و آلو و سیب زمینی که 48 کروموزوم دارند و انسان 46 و قارچ پنیسیلیوم (یوکاریوت است) فقط یک جفت کروموزوم دارد و...

7- تعیین جنسیت در پرندگان ، پروانه ها و بید ها توسط نوع جاندارماده صورت می گیرد. تعین جنسیت در ملخ و انسان بر عهده ی(کروموزوم ) نوع نر است. « پرندگان ، پروانه ها ، بیدها کروموزوم های نوع ماده بصورت ZW نمایش داده می شود و نر ها بصورت ZZ .

8- در ملخ کروموزوم های جنس ماده بصورت XX (شبیه ماده در انسان) و نوع نر هم بصورت XO است.

9- در انسان کروموزوم های جنس ماده بصورتXX و نوع نر بصورت XY است.(دانستن نوع کروموزوم ها در محاسبات بیماری ها و یا صفات وابسته به جنس در این نوع جانداران برای فصول آینده ضروریست)  

10- انواع جهش ها: مضاعف شدن، کروموزوم های همتا حضور دارند و در این نوع جهش کروموزوم از بعضی از ژن ها دو نسخه دارد. در جهش جابجایی: ژن جدا شده(شکسته شده) به کروموزوم غیر همتا متصل می شود. در جهش حذفی قطعه ای از کروموزوم که شکسته شده کاملا از آن جدا می شود و سلول جدید بعد از تقسیم به علت نداشتن بعضی از ژن ها ممکن است از بین برود.

11- چرخه ی سلولی شامل چند مرحله است. که عبارتند از G1 و  S و G2 و میتوز است. اینتر فاز شامل سه مرحله ابتدایی رشد سلول است که عبارتند از G1 و  S و G2 و در واقع از پایان یک تقسیم تا آغاز یک تقسیم دیگر است.

 12- مرحله ی G1 : سلول در این مرحله از چرخه ی سلولی رشد می کند و بزرگ می شود و رشد کردن سلول مستلزم پروتئین سازی بیشتر و در نتیجه میزان ساخته شدن mRNA بیشتر است و این مرحله فاصله ی زمانی بین پایان میتوز و آغاز همانند سازی( مرحله S ) است.

13- (سنتز S): در این مرحله همانند سازی DNA انجام می شود بنابر این در پایان این مرحله هر کروموزوم از دو کروماتید یکسان که در محل سانترومر به هم متصل هستند تشکیل شده است ولی کروماتید ها در این مرحله هنوز فشردگی و تراکم لازم را پیدا نکرده اند. دو کروماتید هر کروموزوم که در محل سانترومر به هم متصل هستند دارای ژن هایی یکسان هستند و در حقیقت یک کروماتید همانند سازی شده ی کروماتید دیگر است.

G2 : در این مرحله تمهیدات لازم برای تقسیم سلول فراهم می شود برای مثال اندامک های مختلف همانند سازی می کنند مانند میتوکندری در سلول های جانوری و کلروپلاست در سلول های گیاهی و همچنین سانتریول(رشته های دوک را می سازد) و ...دو برابر می شوند.

14- میتوز: مراحل میتوز عبارتند از: پروفاز ، متافاز ، آنافاز ، تلوفاز.

15- در مرحله پروفاز: رشته های دراز و در هم تنیده ی کروماتینی به تدریج کوتاه و ضخیم می شوند و کروموزوم ها که همانند سازی کرده اند (S ) قابل رویت می شوند، پوشش هسته ناپدید و با دور شدن سانتریول ها که در این مرحله دو جفت هستند رشته های دوک تشکیل می شود.(به طور مختصر: پوشش هسته ناپدید، کروموزوم ها ضخیم، رشته های دوک تشکیل می شوند.)

متافاز: در این مرحله کروموزوم ها به سمت وسط سلول حرکت می کنند و در سطح استوایی سلول ردیف می شوند. در این مرحله رشته های دوک از یک سمت به سانترومر کروموزوم ها و همچنین از سوی دیگر به سانتریول ها متصل اند. در این مرحله کروموزوم ها کوتاه ترین و قطور ترین ضخامت و حداکثر فشردگی را دارند.

آنافاز: در این مرحله کروماتید ها از محل سانترومر از هم جدا می شوند و با کوتاه شدن رشته های دوک به سوی قطبین سلول حرکت می کنند.

تلوفاز: پوشش هسته تشکیل می شود.

16- سیتوکینز: فرآیندی است که در آن سیتوپلاسم سلول تقسیم می شود و معمولا بعد از تقسیم هسته بوقوع می پیوندد ولی در بعضی از سلول ها سیتوکینز انجام نمی شود در نتیجه ی آن و با تکرار چرخه، ساختار های چند هسته ای بوجود می آید مانند سلول های ماهیچه ای مخطّط (ارادی) پس از مراحل جنینی بنابراین میزان کروماتین در این نوع سلول ها بسیار بیشتر از سایر سلول ها خواهد بود.  

17- تقسیم سلول باید کنترل شود به همین منظور بین مراحل مختلف رشد سلولی نقاط وارسی check point وجود دارد که این نقاط در بین مراحل G1 به S وجود دارد و بین G2 به میتوز هم وجود دارد و همچنین میتوز به سیتوکینز. سرطان تقسیم و رشد غیر عادی سلول هاست، سلول های سرطانی بدن توجه به مکانیسم های کنترل کنند سلامت بدن تقسیم می شوند بعضی از جهش ها سبب تولید بیش از حد مولکول های محرک رشد و تقسیم سلول ها می شوند و از این طریق سلول ها سرطانی می شوند. اغلب سلول ها 90%  زندگی خود را در مرحله ی اینترفاز و 10%  بقیه را در مرحله ی میتوز و سیتوکینز می گذرانند.

18- سلول های جانوران معمولا یک جفت سانتریول دارند که در نزدیکی هسته قرار دارد. هر سانتریول شامل یک جسم کوچک استوانه ای شکل است. دو سانتریول سلول با زاویه 90 درجه نسبت به یکدیگر قرار دارند یکی عمودی و دیگری افقی. طی مرحله G2 که در آن اندامک ها همانند سازی می شوند، سانتریول ها هم که یک جفت هستند همانند سازی می کنند و در نتیجه سلول به هنگام ورود به مرحله میتوز دارای دو جفت سانتریول است یعنی چهار سانتریول. بعد از ورود به مرحله ی میتوز جفت سانتریول ها شروع به دور شدن از هم می کنند و هر یک از جفت سانتریول ها به سوی یکی از دو قطب سلول حرکت می کنند و از جفت سانتریول دیگر دور می شود. هر سانتریول از دو استوانه عمود بر هم تشکیل شده و هر استوانه خود شامل 9 دسته ی سه تایی میکروتوبول بکار رفته (میکروتوبول ها ساختاری پروتئینی دارند) و در مجموع یک سانتریول از 27 میکروتوبول تشکیل شده و در نتیجه یک سلول قبل از مرحله ی G2 54 میکروتوبول دارد.

19- در سلول های گیاهی که دیواره سخت دارند سیتوپلاسم به روشی دیگر تقسیم می شود. در سلول های گیاهی ویزیکول هایی که توسط دستگاه گلژی ساخته می شوند در میانه ی سلول به یکدیگر می پیوندند و صفحه ای را پدید می آورند که در واقع دیواره ی سلولی است که توسط غشا احاطه شده. در سلول های جانوری و سلول هایی که دیواره ی سلولی ندارند کمربندی از رشته های پروتئینی در میانه ی سلول ایجاد می شود که با تنگ شدن آن سلول به دو نیم تقسیم می شود. در سلول های گیاهان عالی سانتریول وجود ندارد اما رشته های دوک تشکیل می شوند و سانتریول در گامت های نر خزه ها و سرخس ها وجود دارد.

مقدار DNA در G1 برابر 2n و در پروفاز و متافاز 4n می باشد و در مرحله آنافاز مجددا به 2n تقلیل می یابد. در انتهای مرحله آنافاز در هر سوی سلول 2n کروموزوم وجود دارد. سلول های عصبی فاقد قدرت تقسیم هستند.  


موضوعات مرتبط: زیست 2

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:25 | نویسنده : زبردستی |

 

1- سلولی با ژنوتیپ AaBb دارای دو جفت کروموزوم همتا یا 4 کروموزوم است که بر روی هر کروموزوم یکی از آلل ها را دارا می باشد، این سلول توانایی تولید 4 نوع گامت را دارد که در هر تقسیم میوز بسته به آرایش متافازی میوزI فقط دو نوع گامت تولید می کند. با توجه به اینکه در هر آرایش متافازی در میوز I دو نوع گامت تولید می شود(در صورت هتروزیگوت بودن) اگر تعداد انواع گامت ها را بر دو تقسیم کنیم تعداد آرایش متافازی بدست می آید برای بدست آوردن انواع گامت ها هم کافیست انواع گامت های هر صفت را محاسبه کنیم و در هم ضرب کنیم: آرایش متافازی =

برای بدست آوردن انواع گامت های یک صفت به مثال توجه کنید:  و   انواع گامت هایی که ژنوتیپ های فوق می توانند بسازند برابر است با 4 و 8   که با تقسیم بر دو می توانیم تعداد آرایش های متافازی آنها را بدست آوریم.

فردی با این نوع ژنوتیپ AA Bb DD فقط دو نوع گامت تولید می کند.

کروموزوم های هوموزیگوت پس از جدا شدن تولید 1 نوع گامت می کنند ولی اگر کروموزوم های همولوگ هتروزیگوت باشند پس از جدا شدن از یکدیگر برای هر صفت 2 نوع گامت حاصل می شود. درانسان کروموزوم x نسبت به کروموزووم Y بزرگتر و دارای ژن های بیشتری است پس سلول های پیکری زن سالم از سلول های مرد سالم ژن های بیشتری دارد.

2- در نشانگان ترنر کاریوتیپ xo را نشان می دهد در واقع یک x کم دارد در مبتلایان به نشانگان فریاد گربه در کروموزوم شماره 5  قطعه ای کمبود دارد. 

 3- هر سلول زاینده انسانی در انجام تقسیم میوز فقط یک نوع آرایش متافازی را می توانند انتخاب کند بنابر این در هر تقسیم میوز فقط 2 نوع گامت حاصل می شود. سلول های انسان با 2n=46 کروموزوم در هنگام تقسیم میوز I تشکیل 23  ساختمان تترادی می دهند و چون هر تتراد (به دلیل متفاوت بودن آلل های کروموزوم های هومولوگ) دو نوع گامت می تواند تولید کند بنابر این سلول های انسانی با 46 کروموزوم توان تولید  گامت را دارد.

3- تعداد کل ژنوتیپ ها برابر است با تعداد ژنوتیپ های هموزیگوت به علاوه تعداد ژنوتیپ های هتروزیگوت و با توجه به اینکه تعداد ژنوتیپ های هموزیگوت همیشه برابر تعداد آلل هاست.

   کل ژنوتیپ ها = ژنوتیپ هتروزیگوت+ ژنوتیپ هموزیگوت

چون انسان موجودی دیپلوئید است  و در هر فرد دو آلل وارد می شود چون الل های فرد هتروزیگوت با هم تفاوت دارند و ترتیب نوشتن آنها هم فرق می کند. تعداد کل ژنوتیپ هتروزیگوت برابر است با ترکیب 2 از مقدار آلل های داده شده. به بیان دیگر از بین 5 نفر به چند طریق می توان کمیته های 2 نفری انتخاب کرد.

4- اگر در جمعیتی برای صفتی n  آلل داشته باشیم تعداد کل ژنوتیپ های موجود برابر است با  اگر بین آلل ها رابطه غالب و مغلوبی وجود نداشته باشد تعداد کل فنوتیپ ها برابر است با تعداد کل ژنوتیپ ها.

5- اگر تعداد کل آلل ها را بدهند چون آلل ها با ژنوتیپ هموزیگوت برابر است و با توجه به فرمول  می توانیم تعداد کل ژنوتیپ ها را مشخص کنیم و با کم کردن از هموزیگوت ها هتروزیگوت ها را بدست آوریم. برای درک بهتر به مثال توجه کنید: اگر 4 آلل داشته باشیم تعداد کل ژنوتیپ ها  برابر است با  و اگر تعداد آلل ها(که برابر است با هموزیگوت ها) را از تعداد کل کم کنیم هتروزیگوت ها را می توانیم بدست آوریم:

6=4-10

6- اگر در یک شجره نامه فرد ناقل مشاهده شود بنابر این صفت مورد بحث مغلوب است(که در این صورت باید مشخص شود که اتوزومی است یا جنسی). از پدر و مادری که به ظاهر سالم هستند فرزندی که مبتلا به بیماری وابسته به جنس مغلوب است(کور رنگی، هموفیلی، دیستروفی عضلانی و ...) متولد شود این فرزند حتما پسر خواهد بود(یعنی از نوع مذکر و پسر ها هم نیمی سالم و نیمی بیمار خواهند بود) چرا که فرزند دختر باید هر دو کروموزوم x مبتلا را دریافت کند. در این شجره نامه پدر و مادر به ظاهر سالم بوده اند و چون فردی مبتلا به بیماری وابسته به جنس مغلوب به دنیا آمده پس پدر حتما سالم و مادر هم ناقل بوده است در مورد کور رنگی می توانیم این ژنوتیپ ها را برای پدر:XY و این ژنوتیپ را برای مادر متصور شویم: . در بیماری کور رنگی (و کلا بیماریهای وابسته به جنس مغلوب) پسر یا بیمار است یا کاملا سالم ولی دختر به علت داشتن دو کروموزوم XX میتواند ژنوتیپ های سالم XX و ناقل   و بیمار  را داشته باشد.

7- گروه های خونی: Rh خون توسط دو الل مشخص می شود، افرادی که Rh+ دارند میتوانند دو نوع ژنوتیپ داشته باشند: RR ، Rr و افرادی که Rh- دارند دارای ژنوتیپ rr هستند در واقع Rh سه نوع ژنوتیپ دارد که در دو نوع فنوتیپ خودش را نشان می دهد که عبارتند از: RR , Rr , rr و گروه های خونی A,B, O گروه های خونی دارای 6 نوع ژنوتیپ هستند که در 4 فنوتیپ خود را نشان می دهند.

18=6 نوع ژنوتیپ گروه خونی ×3 نوع ژنوتیپ Rh

8= 4 نوع فنوتیپ گروه خونی× 2  نوع فنوتیپ Rh

8- افرادی که صفت مغلوب را نشان می دهند دارای دو آلل مغلوب هستند که فراوانی هر یک از آنها برابر  است. aa=

9- گروه خونی A+ با شرط هتروزیگوت بودن می شود:  و هموزیگوت=   فرد هتروزیگوت توانایی تولید چهار نوع گامت را داراست. اگر موجودی دارای دو جفت کروموزوم باشد با آلل های مختلف (دو جفت کروموزوم یعنی چهار کروموزوم) هر جفت توانایی تولید دو گامت را داراست و در کل چهار نوع گامت تولید می شود.

10- از آمیزش دو خوکچه ی هندی سیاه هتروزیگوت Bb با هم Bb×Bb روابط زیر را خواهیم داشت:

( B+ b)( B+ b)= BB+ Bb+ bb

با توجه به روابط بالا  ژنوتیپ ها هتروزیگوتBb و  = × هم هموزیگوت هستند. اگر روابط غالب و مغلوبی وجود داشته باشد آلل غالب با حرف بزرگ نمایش داده می شود.

11- ژنوتیپ ها گروه خونی B+ = , , ,   و همین طور سایر گروه ها را میتوان نوشت...البته گروه خونی O- به این صورت است:iirr

12- گاهی گروه های خونی را با ژنوتیپ بیمار یها با هم می نویسند برای مثال: فردی که هموفیل است و گروه خونی A+ دارد و برای این صفات هتروزیگوت است می شود:  کور رنگی(دالتونیسم) را با نماد c و هموفیل را با نماد h نشان دادیم و چون هتروزیگوت است قادر به تولید حداکثر گامت هاست و 8 نوع گامت می تواند تولید کند(8=2×2×2).

13- پدری که هموفیل است ژنوتیپ آن به این صورت خواهد بود:  و ژنوتیپ مادر سالم و هموزیگوتxx است فرزندان این زوج هیچ کدام بیمار نخواهد بود ولی نصف دختران ناقل خواهند شد! به این صورت که:

× xx=( + y)(x)= + xy

14- در بیماری کم خونی داسی شکل با توجه به اتوزومی بودن و مغلوب بودن بیماری ، ژنوتیپ ها اینچنین هستند: (SS,Ss,ss) اگر پدر و مادر سالم و هتروزیگوت باشند بنابراین داریم Ss×Ss

15- در بیمار های اتوزومی مغلوب هیچ گاه نمی توان انتظار داشت از پدر و مادری بیمار فرزندانی سالم یا ناقل بوجود آیند چون در بیمار های اتوزومی فرد بیمار هموزیگوت است و افراد همزیگوت بیمار نمی توانند افراد هموزیگوت سالم یا هتروزیگوت ناقل  بوجود آورند چون تنها آلل هایی که بوجود می آید الل های مغلوب است! در بیماری های اتوزومی مغلوب اگر فرد بیمار از پدر و مادر سالم(به ظاهر) بدنیا بیایید پدرو مادر در واقع هر دو ناقل بوده اند((Pp و از آمیزش آنها Pp×Pp چنین نسبت هایی را می توان انتظار داشت:  و اگر بخواهیم نسبت دختر ها و پسر ها را بدست آوریم چون این بیماریها اتوزومی هستند و جنسی نیستند باید هر نسبت را در  ضرب کرد.

16- در بیماری کور رنگی xx زن سالم و  زن ناقل ولی به ظاهر سالم است و  زنی مبتلاست و در واقع سه نوع ژنوتیپ داریم که در دو نوع فنوتیپ خود را نشان می دهد.

اگر در شجره نامه پدر و مادر سالم باشند و فرزندانی بیمار وجود داشته باشد آن بیماری مغلوب است چون در صفات وابسته به جنس دختر مبتلا حتما پدری بیمار داشته...

 

منبع: گاهنامه زیست شناسی


موضوعات مرتبط: زیست 2

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:23 | نویسنده : زبردستی |
 

1- دانشمندان در ابتدا نمی دانستند که ماده ی وراثتی کدام یک از مولکول های درون سلول است. اما می دانستند برای آنکه مولکولی بتواند نقش ماده ی وراثتی را ایفا کند باید ویژگی هایی داشته باشد برای مثال بتواند، اطلاعات وراثتی را در خود ذخیره کند، آنها را از نسلی به نسل دیگر منتقل نماید و در عین حال نسبتا پایدار باشد تا بتواند در سراسر زندگی فرد، خود را حفظ کند.  هر یک از مولکول های درون سلول می توانند در جهان غیر زنده (خارج از سلول) هم وجود داشته باشند.

2- عامل اصلی بیماری سینه پهلو نوعی باکتری است به نام استرپتو کوکوس نومونیا (استرپتو یعنی ساختار های رشته مانند بوجود می آورند و کوکوس هم به معنای آن است که این باکتری کروی شکل است) و باکتری ها از نظر شکل دیواره سلولی در سه گروه قرار می گیرند: کوکوس ها که کروی هستند ، باسیل ها که میله ای هستند ، اسپریل ها که مارپیچی هستند. باکتری استرپتو کوکوس نومونیا (سویه کپسول دار) کپسولی از جنس پلی ساکارید دارد که باعث حفاظت باکتری در برابر دستگاه دفاعی بدن می شود و بیماری زا است در حالی که باکتری بدون کپسول بیماری زا نیست. آزمایش گریفیت مشخص کرد که اگر باکتری های بدون کپسول زنده را به همراه باکتری های کپسول دار مرده به موش ها تزریق کند باکتری های بدون کپسول ، کپسول دار می شوند که این حقیقت حاکی از انجام ترانسفورماسیون است. نوکلئاز آنزیمی است که باعث تخریب ماده ی ژنتیکی می شود و هنگامی که دیوری و همکارانش از نوکلئاز استفاده کردند مشاهده کردند که ترانسفورماسیون انجام نشد در نتیجه مشخص شد که  DNA مسئول ترانسفورماسیون و ماده ی سازنده ی ژن هاست! علت کپسول دار شدن باکتری ها در آزمایش گریفیت ورود ژن کپسول باکتری به باکتری بدون کپسول زنده است.  

3- واحد های سازنده: لیپید ها: اسید های چرب و گلیسرول. کربوهیدرات ها: انواعی از مونوساکارید. پروتئین ها: اسید های آمینه . نوکلئیک اسید ها:(DNA , RNA) نوکلئوتید هم خود شامل یک باز آلی و یک قند پنج کربنی(ریبوزC5H10O5 یا دئو اکسی ریبوزC5H10O4) و یک یا دو یا سه گروه فسفات است. باز های آلی: آدنینA ، گوانین G ، تیمین T و سیتوزین C و در RNA به جای تیمین باز یوراسیل U وجود دارد. ربیوز یک قند پنج کربنی و مونوساکارید است و فرمول ساختمانی آن که در RNA حضور دارد عبارت است از C5H10O5 و دئوکسی ریبوزC5H10O4 که فقط یک اکسیژن کمتر از ریبوز دارد و در ساختمان DNA حضور دارد.

4-  در ساختمان مارپیچی DNA  دو ستون دیده می شود که این ستون ها از گروه های فسفات و قند دئوکسی ریبوز تشکیل شده است و این ستون ها بوسیله ی چهار نوع باز( جفت بازها)  به هم متصل می شوند. اگر ساختار DNA را شبیه نردبان در نظر بگیریم این نردبان ستون هایی دارد و پله هایی که دو ستون را به یکدیگر متصل نگه می دارد در درشت مولکول DNA  ستون ها قند و فسافت(با پیوند فسفو دی استر یا کوالانسی) است و پله ها ، باز هایی که با پیوند هیدروژنی با هم جفت شده اند. در ساختار DNA در مقابل باز آدنین A همیشه باز تیمینT  قرار می گیرد(فقط در DNA )  و در مقابل باز گوانین G  هم در DNA و هم در RNA همیشه باز سیتوزین C قرار می گیرد.  در بین نوکلوتید ها که در خزانه ی ژنی می توانند حضور داشته باشند پنج نوع نوکلوتید وجود دارد که فقط چهار نوع از آن می تواند در ساختار مولکول های DNA  و RNA  شرکت کنند.

5- باز های C و T و U تک حلقه ای هستند که به آنها باز های پریمیدینی می گویند و در مقابل باز های دو حلقه ای عبارتند ازA و G که به این دو پورینی می گویند. در یک مولکول DNA به این علت که در مقابل یک باز تک حلقه ای یک باز دو حلقه ای قرار می گیرد تناسب قطر(2nm ( رشته همیشه حفظ می شود. قانون جفت شدن باز ها باعث می شود که همواره نسبت باز A آدنین با تیمین برابر و همچین نسبت G با C نیز برابر باشد(قانون چارگف) نسبت مولی را می توان این چنین بیان کرد:A+C=G+T  و یا A+G=T+C برای مثال: اگر در یک مولکول DNA مقدار نوکلئوتید گوانین 27% باشد مقدار نوکلئوتید تیمین چقدر است؟

برای حل این مسئله با توجه به نسبت بین بازها ، می دانیم اگر مقدار گوانین 27% باشد مقدار سیتوزین هم همین مقدار خواهد بود پس این دو باز در مجموع 54% از مقدار کل باز ها را شامل می شوند و اگر این مقدار را از صد کم کنیم عدد حاصل برابر 46% خواهد بود که در واقع مجموع مقادیر دو باز آدنین و تیمین است پس هر کدام به دلیل برابر بودن نسبتشان می شود 23%T و 23%. A

6-فرمول ها:برای محاسبه ی تعداد پیوند های فسفو دی استر; DNA مولکولی دو رشته ای است! بنابر این اگر تعداد جفت نوکلئوتید ها را داشته باشیم باید تعداد را در عدد 2 ضرب که عدد حاصل برابر است با تعداد کل نوکلئوتید ها که آنرا مساوی n قرار می دهیم و با استفاده از فرمول n-2 می توانیم تعداد پیوند های فسفو دی استر بین قند ها و گروه های فسفات را بدست آوریم. فرمول n-1 تعدادپیوند های فسفودی استر را در یک رشته محاسبه می کند.

7- ویلکینز و فرانکلین با مطلع بودن از ماهیت اسید نوکلئیک، تصاویری از بلور های مولکول DNA با روش پراش پرتو x تهییه کردند. بر اساس این تصاویر مشخص شد که مولکول DNA مارپیچی از دو یا سه زنجیره تشکیل شده اما از دو رشته ای بودن آن خبر نداشتند. میزان اشتباه در همانند سازی در اثر عمل آنزیم DNA پلی مراز (ساختار پروتئینی دارد و واحد سازنده ی آن آمینو اسید است و در سیتوپلاسم سنتز می شود)  در حدود 10 به توان 9- می باشد یعنی احتمالا از هر یک میلیارد نوکلئوتید که در ساختمان DNA قرار می گیرد یک نوکلئوتید اشتباهی است. سرعت همانند سازی در پروکاریوت ها(اندامک های غشا دارد ندارند و ...) بیشتر از یوکاریوت هاست.

8-  باکتری ها دارای DNA حلقوی هستند معمولا 2 دوراهی همانند سازی ایجاد می کنند. این دو راهی در یک نقطه خاص بوجود می آیند و بتدریج دوراهی از هم دور می شوند تا در یک نقطه ، مقابل نقطه ی آغاز به هم برسند. اما یوکاریوت ها دارای DNA خطی هستند که بسیار طویل است، از این رو همانند سازی در سلول های انسانی و سایر سلول های یوکاریوتی در نقاط مختلف انجام می شود برای مثال هر کروموزوم انسان همانند سازی را در صد نقطه و با هم شروع می کنند که طول هر ناحیه 100000  نوکلئوتید است! برای همانند سازی مولکول DNA موجود در یک انسان حدود 8 ساعت وقت نیاز است. هر چه اندازه مولکول DNA بیشتر باشد احتمال وقوع جهش در آن نیز بیشتر خواهد بود .

9- در انسان کروموزوم ها از بزرگ به کوچک شماره گذاری می شوند مثلا کروموزوم شماره یک بزرگترین و کروموزوم های 21 و 22 کوچکترین هستند. در همانند سازی دو طرفی در پروکاریوت ها تنها یک نقطه آغاز همانند سازی وجود دارد.

10- به ازای هر نوکلئوتید یک گروه فسفات داریم.

11- آنزیم هیلیکاز با شکستن پیوند هیدروژنی موجود بین جفت بازهای مکمل باعث باز شدن دو رشته می شود.

12- ATP  آدنوزین تری فسفات تفاوتی که با باز آدنین دارد در تعداد فسفات است. اگر تعداد قند های ریبوز و گروه های فسفات را داشته باشیم(نسبت این دو با هم برابر است) می توانیم نسبت باز های پورینی(A وG ) و پریمیدینی(C وUو T) را با تقسیم بر دو کردن بدست آوریم.

13- باز های مشترک بین RNA و DNA عبارتند از A وG وC .

14- نتیجه همانند سازی DNA یک زنجیره ی قدیمی و یک زنجیره ی جدید است که به هر یک از سلول های دختری می رسد.  

 


موضوعات مرتبط: زیست 2

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:21 | نویسنده : زبردستی |
 

1-     تقسیم میوز باعث تولید گامت می شود (گامت سلولی هاپلوئید است که باعث تنوع ژنتیکی و همچنین عدد کروموزومی از نسلی به نسل دیگر افزایش نیابد).

2-      برای تقسیم میوز فقط یکبار همانند سازی DNAانجام می شود که در مرحله S اینترفاز است.

3-     میوز خود شامل دو مرحله است، میوزI و میوزII که در پایان هر مرحله عمل سیتوکینز اتفاق می افتد یعنی در مجموع دوبار سیتوپلاسم تقسیم می شود.

4-      تشکیل تتراد از ویژگی های پروفاز میوز I است و کروموزوم های همتا در آنافاز I از هم جدا می شوند(بدلیل وجود ساختار تتراد) و در آنافاز که سومین مرحله است و درمیوزII کروماتید های خواهری از هم جدا می شوند در واقع تفاوت بین این دو مرحله است.

5-     سلولی دیپلوئید که 44 کروموزوم دارد با تقسیم میوز چهار گامت بوجود می آورد که هر گامت 22 کروموزوم دارد این چهار گامت دو به دو با هم یکسان هستند و در واقع دو نوع گامت هاپلوئید بوجود می آید.

6-     تعداد نواری های پلی نوکلئوتیدی DNA  دو برابر تعداد کروموزوم هاست.

7-     اسپرم و تخمک در هر جانوری دارای n کروموزوم است به این معنا که یک سری کروموزوم دارد( کروموزوم ها دو کروماتیدی نیستند) .

8-     نحوه ترتیب تتراد ها روی دوک متافازی از رابطه 2 به توان  n-1 بدست می آید که به جای  n  عدد هاپلوئیدی را قرار می دهیم برای مثال اگر سلولی در حال دیپلوئیدی (2n ) 8 کروموزوم داشته باشد که در این صورت عدد هاپلوئیدی که برابر 4 می شود را در رابطه قرار می دهیم 4-1=3 و عدد 2 را به توان سه می رسانیم که می شود 8 که این سلول 8 نوع آرایش متافازی را میتواند داشته باشد.

9-     برای بدست آوردن تعداد نوارهای پلی نوکلئوتیدی تعداد کروموزوم های در حالت دیپلوئیدی را در عدد 4 ضربی می کنیم(یک کروموزوم دو کروماتیدی چهار نوار پلی نوکلئوتیدی دارد و یا یک کروماتید از دو نوار تشکیل شده) .

10- در آنافاز میوزII دو کروماتید از محل سانترومر از هم جدا می شوند مشابه آنچه در آنافاز میتوز انجام می شود(میتوز ~میوز(II . ویژگی عمده تقسیم میوز جفت شدن طولی کروموزوم های همتا در پروفاز میوزI می باشد(تتراد ها) و تولید گامت است.

11-  میوز فقط در سلول های دیپلوئید انجام می شود و سلول هایی هاپلوئید ایجاد می کند اما میتوز هم در سلول های هاپلوئید و هم در سلولی های دیپلوئید انجام می شود و سلولی که در نهایت بوجود می آید از نظر ژنتیکی مشابه سلول والد است.

12- سلول هایی که اسپرم و تخمک تولید می کنند 2nهستند و با تقسیم میوز گامت های هاپلوئید ایجاد می کنند(گامت ها همیشه هاپلوئید هستند).

13- در تخمک سازی در پایان میوز I  دو سلول حاصل می شود که از نظر مواد وراثتی یکسان ولی از نظر مقدار سیتوپلاسم متفاوت هستند.

14- تخمک نابالغ و اولین گویچه قطبی در آخرین مرحله میوزI بوجود می آیند و میوز II را انجام می دهند و سرانجام تخمک تمایز نیافته و دومین گویچه قطبی را بوجود می آورند.

15-  با توجه به خاصیت تقسیم میوز: تخمک نابالغ و اولین گویچه قطبی دارای کروموزوم های دو کروماتیدی هستند اما تخمک نابالغ و دومین گویچه دارای کروموزوم هایی تک کروماتیدی هستند. سلول های حاصل از اولین تقسیم میوزی ضمن اسپرماتوژنز اسپرم های نابالغ نام دارند و در مرحله ی بعدی میوزتبدیل به اسپرم های تمایز نیافته و سپس به اسپرم تبدیل می شوند. نتیجه تقسیمات سلول های زاینده ی اسپرم و سلول های زاینده ی تخمک در جریان گامت زایی به ترتیب 4 اسپرم فعال و 1 تخمک است.(ساختار اسپرم و تخمک و چرخه های آن در فصل 11 بررسی خواهد شد) مقایسه مراحل مختلف میوز بین تخمک و اسپرم از نظر مضاعف بودن و یا تک کروماتیدی بودن مهم است!برای مثال ممکن است اولین گویچه قطبی با اسپرم تمایز یافته مقایسه شود و یا حالت های کروموزوم ها( همتا بودن، تک کروماتیدی بودن، مضاعف بودن و مقدار DNA و ...) بین مراحل میوز حتی با میتوز.

16- برای مثال: اگر در تخمک تمایز نیافته 7 کروموزوم غیر جنسی وجود داشته باشد در تخمک نابالغ چند کروموزوم جنسی و غیر جنسی وجود دارد؟ج- تخمک نابالغ هم 7 کروموزوم خواهد داشت و همچنین یک کروموزوم جنسی که در مجموع می شود 8 کروموزوم... .

17- کاریوتیپ تصویری است که کروموزوم های در حال تقسمیم بر حسب اندازه ردیف شده اند.  در کاریوتیپ هسته سلول انسانی کروموزوم ها در 7 گروه غیر جنسی و یک گروه جنسی و در مجموع هشت گروه تقسیم بندی می شوند. بزرگترین کروموزوم ها در گروه اول قرار می گیرد و در اخرین گروه هم کوچکترین کروموزوم ها احتمال ایجاد جهش درکروموزوم های بزرگتر بیشتر از کروموزوم های کوچک است.

18- افراد مبتلا به نشانگان داون(تری زومی 21)، کروموزوم 21 اضافی دارند و فرد بیمار 45 کروموزوم اتوزومی دارد(غیر جنسی) و دو کروموزوم جنسی. احتمال تولد فرزندان مبتلا به این نشانگان با افزایش سن مادر نسبت مستقیم دارد و احتمال آن بیشتر می شود. و کروموزوم های همتا در مرحله آنافاز I  از هم جدا می شوند.

19- تولید مثل غیر جنسی: فرزندان کاملا شبیه والدین هستند- فقط یک والد شرکت دارد- در بسیاری از یوکاریوت ها نیز دیده می شود و مخصوص پریکاریوت ها نیست و ممکن است جاندارانی هاپلوئیدی یا دیپلوئیدی بوجود آورند فردی که به طریق غیر جنسی بوجود می آید یک کلون است.

20- بکر زایی نوعی تولید مثل است که در آن فرد از تخمک لقاح نیافته رشد و نمو می یابد و در واقع نوعی تولید مثل جنسی است و فرزندان حاصل کاملا شبیه مادر هستند و در جاندارانی مانند بعضی از ماهی ها سوسمار ها و قورباغه ها، زنبور عسل ماده(فقط تولید زنبور عسل نر می کند) و قاصدک ها دیده می شود.

21- در چرحه زندگی هاپلوئیدی گامت ها با روش همجوشی در هم الحاق می شوند و در چرخه دیپلوئیدی از طریق لقاح.

22- چرخه زندگی انسان دیپلوئیدی است. 


موضوعات مرتبط: زیست 2

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:19 | نویسنده : زبردستی |

فهم

            

آيا دالي يك جاندار تراژني محسوب مي شود؟چرا ؟

                                                              

7

 

 

ارزشيابي

             

در يك مسير متابوليسمي  جهش دركدام ژن شانس بقاي موجود زنده را كمتر مي كند: ژن آنزيم هايي كه دراوايل تكامل به وجود آمده اند يا ژن آنزيم هاي جديدتر؟توضيح دهيد.

8

 

دانش

             

نظريه درون همزيستي درمورد چه محدوده ي زماني در تاريخ تكامل ارائه شده است؟                                                           (به صورت" میليارد سال پيش "بيان كنبد ).

                      

9

 

ارزشيابي

              

انقراضهاي گر وهي چه نقشي در تنوع گونه اي داشته اند ؟ بااشاره به انقراض گروهي پنجم توضيح دهيد.

10

 

 

 

 

كاربرد

 

 

           

مهره داران A. تا  Eرا به صورت يك درخت تكامل مرتب كنيد .

A  پولك تبديل به مو شده است-   داراي دست وپا

B  داراي پولك درسطح پوست -  بدون دست وپا ولي داراي استخوان ران بصورت  وستيجيال

C پولك تبديل به پر شده است -  داراي پا- ودستها تبديل به بال شده اند

D داراي پولك درسطح پوست -  بدون دست وپا

E داراي پولك درسطح پوست -  داراي دست وپا

11

 

فهم

 

وقوع گونه زايي در ابعاد بسيار گسترده بعداز تغییرات جوی در یک دوره زمانی خاص ، مطابق كدام الگوي تغيير گونه ها بهتر توجه مي شود؟توضيح دهيد.

 

               

12

 

 

 

فهم

 

             

دانشمندان احتمال مي دهند اعضاي دو گروه سهره هاي كامرون كه داراي اندازه هاي متفاوت منقار هستند باوجود زندگي درزيستگاه مشترك وامكان آميزش باهم ، درحال اشتقا ق هستند

الف-  علت گونه زايي را توضيح دهيد.

ب - كدام نوع گونه زايي دراين مورد مصداق دارد ( دگر ميهن يا هم ميهن؟)

ج-كدام نوع ساز وكار جداكننده دراين جدايي خزانه هاي ژن نقش دارد ؟

13

تركيب

چراگندم تريپلوئيد بدون دانه است؟

14

كاربرد

%1 اززنان جمعيتي مبتلا به تحليل عضلاني دوشن و%1 ازمردان اين جمعيت مبتلا به بيماري زالی هستند . چه نسبت از افراد این جامعه به هر دو اين بيماري هاي مغلوب مبتلا هستند؟


موضوعات مرتبط: زیست پیش

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:17 | نویسنده : زبردستی |

سطح

 

نيمسال اول 87-86

رديف

تركيب

اگر در آزمايش نير نبرگ به جاي يوراسيل ، تمامي نوكلئوتيدهاي پيريميديني را به كار بريم ، با mRNA

ساخته شده حداكثر چند نوع اسيد آمينه رمز مي شود؟

 

1

 

كاربرد

 

  اگر مولكول m RNA اي  n  كدون داشته باشد ، مجموع تعداد كدونهايي كه هيچگاه در جايگاه P قرارنمي گيرند و

قرار نمي گيرند را حساب كنيد؟ Aكدونهايي كه هيچگاه در

2

 

 

فهم

جدو ل زيرراكامل كنيد .

                                                                 mRNA                    تك ژني     چند ژني

                                   ( داشتن + ،  نداشتن - )

پروكار يوت

 


يوكاريوت

3

 

 

ارزشيابي

 

 

 

در دو آزمايش مجزا تعداد پيوندهاي فسفودي استري شكسته شده  در بالغ شدن يك مولكول RNA برابر است با تعداد پيوندهاي فسفودي استري شكسته شده حاصل از تا ثير يك آنزيم محدود كننده بر ژن مربوط به آن  RNA ، چه نسبتي بين تعداد اینترونها وتعداد قطعات ‌DNA حاصل از تاثير آنزيم محدود كننده وجود دارد؟  (تعداد اينترونها راI  وتعداد قطعات DNAرا D  فرض نموده و فرمولي ارائه دهيد.)

 

 

4

 

 

تجزيه وتحليل

 

شکل مقابل نتایج الکتروفورز اللهای ژن یک بیماری وراثتی را در یک خانواده مورد بررسی نشان میدهد.

الف – نوع بیماری را مشخص کنسد.                محل الل سالم

ب – ژنوتیپ فرزند      رامشخص کنید.(بر اساس قوانین احتمالات )

 

                                                      محل الل بیمار

                                     فرزند    فرزند                                     مادر        پدر

                                                     

5

 

 

 

كاربرد

 

 

 

 

با تزريق ويروس هرپس تناسلی تهیه شده از راه مهندسی ژنتیک  كدام وقايع زير روي مي دهد وكدام روي نميدهد .جلوي هرموردتوضيح دهيد:

الف  - پادتنهاي هرپس تناسلي ساخته ميشود:

ب  -  پادتنهاي آبله گاوي ساخته ميشود:

ج-سم هرپس تناسلي دربدن شخص توليد مي شود:

 

6


موضوعات مرتبط: زیست پیش

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:14 | نویسنده : زبردستی |
 

1- كدام جاندار شانس بيشتري براي سنگواره شدن دارد؟

1)سنورابديتيس الگانس           2)بيستون بتولاريا             3)پلاناريا                4)لامپري

2- كدام موجب ارزيابي مجدد نظريه سوپ بنيادين گرديد؟

1)نقش مولكول اكسيژن در جذب الكترونهاي پر انرژي در آغاز حيات ناديده گرفته شده بود.

2)در آغاز حيات آب براي انجام واكنشها موجود نبوده است.

3)در شرايط آغاز حيات ، امكان تشكيل انواع اسيد هاي نوكلئيك وجود نداشت.

4)در آغاز حيات مولكولهاي اساسي موثر در تشكيل مواد آلي اوليه به راحتي تجزيه مي شده اند.

3- اولين مولكول خود همانند ساز در آغاز حيات فاقد كدام ويژگي بود؟

1)فعاليت آنزيمي   2)تغيير پذيري طي نسل هاي متمادي

3)توانائي حفظ و انتقال اطلاعات   4)داشتن اسيد آمينه در ساختار مولكولي

4)به دنبال كداميك اتوتروفها بوجود آمدند؟

1)كمبود ميزان اكسيژن جو 2)افزايش ميزان اكسيژن جو

3)كاهش غلظت مواد آلي در اقيانوسها 4)افزايش غلظت مواد آلي در اقيانوسها

5-كداميك جزء ويژگيهاي ميكروسفرهاي اوليه محسوب نمي شود؟

1)انسجام ساختار 2)ارتباط با محيط اطراف

3)توانائي كسب انرژي 3)خصوصيات وراثتي

6)ژنهاي مربوط به سيانوباكتريها و پروكاريوت هاي هوازي تواما در كداميك بيشتر ديده مي شود؟

1)سلولهاي كپك نوروسپورا 2)ريزوبيوم 3)E.coli  )تار كشنده در سيب

7-كداميك از لحاظ تكاملي قدمت بيشري دارد؟

1)غشاء داخلي كلروپلاست 2)غشاء خارجي كلروپلاست 

3)غشاء خارجي ميتوكندري   4)ريبوزوم

8-اولين محصول فتوسنتز در خشكي از نظر تكاملي توسط كداميك توليد شده است؟

1)ساكاروميسس سريزيه 2)گياهان گلدار اوليه 3)جلبك ها 4)سرخسها

9-كدام گروه از جانوران قدمت تكاملي بيشتري دارند؟

1)دوزيستان 2)ماهيهاي دو تنفسي 3)حشرات  4)پستانداران

10-آزمايشات ميلر ......................................

1)تشكيل مواد غير شيميائي پايه اي حيات را از مواد شيميائي نشان داد.

2)تشكيل مواد غير آلي پايه اي حيات را از مواد آلي نشان داد.

3)تشكيل مواد شيميايي پايه اي حيات را از مواد آلي نشان داد.

4)تشكيل مواد شيميائي پايه اي حيات را از مواد غير آلي نشان داد.

11-واحد سازنده اولين مولكولي كه در ابتداي حيات رونوشت برداري شد كدام است؟

1)ريبونوكلئوتيد 2)داكسي ريبو نوكلئوتيد 3)نوكلئو پروتئين  4)گليكو پروتئين

12-كداميك از اختصاصات خزندگان آبزي نمي باشد؟

1)لقاح داخلي 2)تنفس با آبشش 3)تخم گذاري در خشكي 4)تنفس با شش

13- كدام گروه از موجودات براي اولين بار در خشكي تخم گذاري نمودند؟

1)خزندگان خشكي زي 2)پرندگان 3 )خزندگان خشكي زي و آبزي 4)حشرات

14-گياهان و قارچها در كدام مورد به هم شبيه اند؟

1)از لحاظ ساختاري    2)اتوتروف بودند 

3)هتروتروف بودن   4)جذب رطوبت و مواد معدني

15-زيست شناسان كدام عامل را دليل بر انقراض جديد مي دانند و با اين انقراض كدام گروه از جانداران بيشتر از بين مي روند؟

1)تغييرات شديد بوم شناختي – گياهان 2)دخالت انسان – پرندگان

3)كاهش دما – بند پايان 4)دخالت انسان - درختان جنگلي

16- كدام جو و به كدام دليل تركيبات آلي پايدار توليد مي كند؟

1)جو كنوني و به دليل اكسيد كنندگي 2)جو اوليه و به دليل احيا كنندگي

3)جو كنوني و به دليل احيا كنندگي 4)جو اوليه و به دليل اكسيد كنندگي

17- قديمي ترين سنگواره اي كه تا كنون كشف شده است ، مربوط به كدام جاندار مي باشد؟

1)پروكاريوت هتروتروف 2)پروكاريوت فتوسنتز كننده 

3)يوكاريوت تك سلولي  4)پروكاريوت شيميو سنتزكننده

18-سنجاقك ها كه اولين جانوران ساكن خشكي بودند ، همزمان با آنها ، درختان جنگل هاي باتلاقي از چه نوع بوده اند؟

1)بازدانگان 2)نهاندانگان 3)نهانزادان آوندي  4)خزه گيان

19-اندامهاي حركتي جلوئي و عقبي دوزيستان ، بترتيب از تكامل كدام استخوانهاي باله ماهي ها بوجود آمده است؟

1)باله سينه اي – باله دمي 2)باله پشتي – باله دمي

3)باله سينه اي – باله شكمي 4)باله پشتي – باله شكمي

20-كدام واكنش شيميائي در درون حباب هاي زير دريائي تشكيل نمي شود؟

1) تبديل آمونياك و متان به آمينو اسيد   2) تبديل آمينو اسيد به پروتئين

 3)تبديل مولكولهاي غير زيستي به مولكولهاي آلي ساده  4)تبديل متان و آب به هيدرات كربن


موضوعات مرتبط: زیست بیش دانشگاهی(تست)

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:11 | نویسنده : زبردستی |

2- مونومر جايگاه آغاز رونويسي وپايان رونويسي به ترتيب كدامند ؟

1- ريبونوكلئوتيد - ريبونوكلئوتيد                                 2- ريبو نوكلئوتيد – داكسي ريبونوكلئوتيد

3- داكسي ريبونوكلئوتيد – داكسي ريبونوكلئوتيد                             4- داكسي ريبونوكلئوتيد- ريبونوكلئوتيد

3- كداميك در مرحله آغاز ترجمه صورت نمي گيرد؟.

1- اتصال جزء بزرگ و كوچك ريبوزوم به همديگر                              2- اشغال شدن جايگاه A  ريبوزوم توسط tRNA

3- اشغال شدن جايگاهp توسط  tRNA                                         4- تشكيل پيوند هيدروژني

4- كداميك از اعمال RNA پليمراز پروكاريوتي نمي باشد؟

1- جدا كردن دو نوار پلي نوكلئوتيدي DNA از همديگر   2- ايجاد پيوند پپتيدي

3-تشكيل پيوند كووالانسي بين ريبونوكلئوتيدها                               4- ايجاد پيوند فسفودي استر

5-كداميك رمز گردانِ كدونهاي قابل ترجمه است ؟

1- اينترون                              2- اگزون                                    3- رونوشت اينترون                                      4- رونوشت اگزون

6- اگردر آزمايشي مشابه نيرنبرگ فقط از بازهاي آلي دو حلقه اي استفاده شود رشته پپتپدي حاصل حداكثر چند نوع آمينواسيد مي تواند داشته باشد ؟

1-  2                                       2-  4                                      3-  6                                        4-  8   

7- كداميك فاقد پيوندهيدروژني است ؟

1- ساختار L  شكل tRNA         2- راه انداز                                3- mRNA ي بالغ                      4- اپراتور

8- در سنتز يك پروتئين در ريزوبيوم , ريبوزوم 7 بار بر روي mRNA جابجا مي شود . بخشي از ملكول دو رشته اي  DNA كه دستور ساخت اين رشته پپتيدي را صادر كرده است . داراي چند نوكلئوتيد مي باشد ؟

1- 21                                   2 – 8                                        3-27                                        4-54

9- قند بكار رفته در كداميك با بقيه متفاوت است ؟

1- عامل تنظيم كننده اپران لك              2- ژن رمز گردان كراتين               3- جايگاه پايان رونويسي                4- توالي افزاينده

10- اگر اپراني داراي 5 محصول آنزيمي باشد تعداد راه انداز و ملكول mRNA ي ساخته شده از روي اين اپران به ترتيب كدامند ؟

1- 4,5                                  2- 5,4                                      3-5,1                                       4- 1,1

11- آلولاكتوز با اتصال به كداميك سبب روشن شدن اپران لك مي شود ؟

1- ژن تنظيم كننده                 2- محصول ژن تنظيم كننده         3- توالي افزاينده                          4- اپراتور

12- هاگ نوروسپوراي جهش يافته در محيط غني شده با تمام آمينو اسيدها رشد نكرد . احتمالاً جهش در ژن سازنده كداميك صورت گرفته است ؟

1- متيونين                             2- آرژي نين                               3- لوسين                                   4- نياسين

13- tRNA با كدام آنتي كدون در سلول وجود ندارد ؟

1- UAC                               2-AAA                                                 3-ACU                                   4-UAA

14- سنتز انسولين از مونومرهاي آن در ...................... سلول صورت مي گيرد و اين يك فرآيند متابوليسمي ..................... مي باشد ؟

1- هسته – انرژي زا             2- هسته -انرژي خواه                      3- سيتوپلاسم-  انرژيزا                          

       4- سيتوپلاسم -  انرژي خواه

15- كداميك در محيط كشت حداقل نوروسپورا وجود ندارد ؟

1- بيوتين                     2- ساكارز                   3- نمك                                     4- لاكتوز

16- ژن رمزگردان RNA پليمراز II توسط كداميك رونويسي ميشود ؟

1- RNA پليمراز پروكاريوتي     2-  RNA پليمراز I                  3- RNA پليمراز II                  4- RNA پليمراز III 

17- در فرآيند تبديل mRNA  ي اوليه به mRNA ي بالغ دريوكاريوتها كداميك رخ نمي دهد؟

1- حذف اينترونها                    2- شكستن پيوند فسفودي استر    3- تشكيل پيوند فسفودي استر          4- كوتاه شدن RNA

18 – تبديل لاكتوز به آلو لاكتوز در ............. باكتري اشريشياكولي صورت ميگيرد و اتصال آن به پروتئين تنظيم كننده سبب .............. شدن اپران ميشود ؟

1- خارج – روشن                    2- داخل – روشن                       3- خارج – خاموش                       4- داخل – خاموش

19 – محل سنتز و فعاليت RNA  پليمر از I  به ترتيب كدامند ؟ 

1- سيتو پلاسم-  سيتو پلاسم    2-  سيتو پلاسم -  هسته                3- هسته -  هسته                          4- هسته -  سيتو پلاسم 

 

20 – پيوند بين آخرين tRNA  و آمينو اسيد در جايگاه ...... ريبوزوم توسط ......... شكسته مي شود ؟

1-A  -  عامل پايان ترجمه        2- P – عامل رونويسي 3- A  - عامل رونويسي                   4- P – عامل پايان ترجمه

 

21- در شكل مقابل حداكثر چند نوع نوكلئوتيد قابل مشاهده است ؟

1- 4                                                                                     2- 8        

3- 9                                                                                     4- 5                   

22- كدام سطح تنظيم بيان ژن دريوكاريوتها بعد از حذف رونوشت اينترونها امكان پذير است ؟

1- آغاز رو نويسي                      2- قبل از رونويسي                      3- هنگام ترجمه                          4- هنگام رونويسي

23- كداميك سبب مي شود كه پروتئين مهار كننده نتواند به اپراتور متصل شود ؟

1- تغيير لاكتوز به الولاكتوز                                                        2- تغيير شكل مهار كننده

3- اشغال شدن اپراتور توسط عامل تنظيم كننده                            4- اشغال شدن اپراتور توسط RNA پليمراز

24- كداميك فاقد ژن هموگلوبين است ؟

1- سلولهاي پوششي روده          2- نورون حسي نخاعي                   3- اريتروسيت بالغ                       4- سلولهاي ماهيچه دلتايي

25- نقش محصول ژن تنظيم كننده در بيان ژن كدام است ؟

1- تبديل لاكتوز به الولاكتوز       2- جذب آلولاكتوز                       3- اتصال به راه انداز                      4- اتصال به اپراتور

26- اگر مجموع آمينو اسيدهاي محصولات اپران لك را با N نشان دهيم . در مرحله ترجمه mRNA ي ساخته شده در مجموع چند پيوند پپتيدي تشكيل مي شود ؟

1- N                                    2-   1-N                                   3-   2-N                                  4-   3-N                    

27- با ايجاد جهش در كپك نوروسپورا ابتدا كداميك دچار تغيير مي شود ؟

1- نوع اسيد سنتز شده             2- نوع پروتئين سنتز شده             3- فنوتيپ                                  4- ژنوتيپ

28- محصول كداميك منحصراً يك نوع RNA مي باشد ؟

1-RNA پليمراز پروكاريوتي      2- RNA پليمراز I                      3- RNA پليمراز II                     4- RNA پليمراز III

29- كداميك در تعيين نوع آمينو اسيد متصل شده به tRNA نقش مهمتري دارد ؟

1- توالي سه نوكلئوتيدي موجود در جايگاه اتصال امينو اسيد

2- توالي نوكلئوتيدهاي شركت كننده در پيوند هيدروژني

3- توالي سه نوكلئوتيدي برگ مياني tRNA

4- نوكلئوتيد انتهايي در جايگاه اتصال امينو اسيد

30- با توجه به طرح مقابل : در اتصال آخرين نوكلئوتيد اضافه شده به mRNA مجموعاً چند پيوند تشكيل شده است ؟

1- 1                                                                                     2- 3                        

3- 4                                                                                     4- 4

 

به يك رشته از DNA با توالي زير دقت كنيد و به سئوالات 31 تا 35  پاسخ دهيد .

TTC3    TAC6    ATG9   cGG12     AGC15        GAA18     ATG21    GGT24     AAT27    TGA30     ACT33    AGC36

 

31-اگر رشته مكمل DNA   ي فوق رونويسي و ترجمه شود رشته پپتيدي حاصل داراي چند پيوند پپتيدي خواهد بود ؟

1- 7                                     2- 8                                         3- 6                                         4- 5 

32- اگر رشته مورد نظر رونويسي و ترجمه شود در سنتز رشته پپتيدي ,ريبوزوم چند بار جابجا خواهد شد ؟

1- 9                                     2- 8                                         3- 7                                         4- 6

33- اگر رشته مكمل DNA ي فوق رونويسي و ترجمه شود اولين كدوني كه در جايگاه A ريبوزوم قرار خواهد گرفت كدام است ؟

1- CGG                               2- ACU                                  3-CCG                                    4- GCG

34- اگر رشته مورد نظر رونويسي و ترجمه شود آخرين كدوني كه در جايگاه p ريبوزوم قرار خواهد گرفت كدام است ؟

1- GAU                              2-ACU                                   3- UUA                                  4- CCA

35- اگر حدفاصل نوكلئوتيد 16 و 15 در رشته مورد نظر 3 نوكلئوتيد پورين دار كه هر كدام در سه پيوند هيدروژني شركت مي كنند اضافه شود رشته پپتيدي حاصل از رونويسي و ترجمه همان رشته دچار كدام تغيير خواهد شد ؟ اضافه يك شدن يك آمينو اسيد .................... در رشته پپتيدي .

ليزين      AAA     گليسين       GGG            پرولين     CCC        فنيل آلانين           UUU

1- فنيل آلانين             2- ليزين                    3- پرولين                 4- گليسين

36- عوامل رونويسي در آميب به كداميك متصل نمي شود ؟

1- راه انداز                             2- توالي افزاينده                          3- RNA پليمراز                        4- منطقه رمز گردان ژن

37- در يوكاريوتها كداميك به جايگاه آغاز رونويسي نزديكتر است ؟

1- توالي افزاينده                      2- جايگاه پايان رونويسي                3- اپراتور                                  4- راه انداز

38- تغيير در كداميك , از نتايج قطعي جهش ها مي باشد ؟

1- فنوتيپ                             2- بيان ژن                                 3- توالي نوكلئوتيد ها در ژن           4- چهار چوب خواندن رمزها

39- پروتئين هايي ك در تنظيم بيان ژن دخالت دارند در كداميك تنوع كمتري دارند ؟

1- اشريشياكولي          2- زنبور عسل            3- تريكودينا                               4- نوروسپورا كراسا

40- در كداميك RNA پليمراز به تنهايي قادر به شناسايي محل نشستن خود بر روي DNA مي باشد ؟

1- ريزوبيوم               2- كلاميدوموناس                        3- اسپيروژير                        4- ولوكس

 


موضوعات مرتبط: زیست بیش دانشگاهی(تست)

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:9 | نویسنده : زبردستی |

1-در حباب رونويسي حداكثر چند نوع نوكلئوتيد وجود دارد ؟

1)4                 2)5                         3)6                           4)8

2-مولكول mRNA اي توسط يك ريبوزوم در حال ترجمه است ، پس از 5 بار حركت ريبوزوم روي اين مولكول mRNA ، حداكثر چند پيوند پپتيدي بين آمينواسيدهاي پپتيد در حال ساخت  وجود دارد؟

1)6                     2)7                        3)5                          4)4

3-در كداميك از حانداران زير ، rRNA وtRNA  توسط يك نوع پليمراز رونويسي مي شود؟

1)تريكودينا                                              2)كاج

3)عامل مولد بيماري مالاريا در انسان        4) عامل مولد بيماري ذات الريه

4-اگر در يك مولكول mRNA در صد هريك از نوكلئوتيدها به صورت زير  باشد، احتمال وجود يك رمز پايان در اين مولكول چقدر است ؟          (A=25%,G=50%,C=12.5%,U=12.5% )

1)128/5                  2)128/1                   3)256/3                      4)256/1

5-با توجه به توالي mRNA مقابل ، در هنگام ترجمه چند رمز از جايگاه P و چند رمز از جايگاه A ريبوزوم عبور مي كند؟

                          CUGAUGGCAAGUCCCAUUCGCACUUGAAUGUAAACC

1)7و7                     2)8و8                         3)9و10                        4)8و9

 

6-اگر وقوع جهش در DNA باعث تبديل رمزATC به AAC شود، در هنگام ترجمه كداميك از موارد زير اتفاق مي افتد؟

1)پروتئين طبيعي ساخته مي شود.      2)پروتئين بلندتر از حد معمول ساخته مي شود.

3)پروتئين ساخته نمي شود.                 4)پروتئين كوچكتر از حد معمول ساخته مي شود.

7-اگر توالي بخشي از مولكول tRNA در حلقه آنتي كدون ACUGUAGAU باشد، توالي مولكول DNA اي كه الگوي اين بخش بوده است، كدام است؟

1)ACTGTAGAT                                                         2)TGACATCTA

3)TCAGATGTA                                                         4)UGACAUCUA

8-در يك مولكول mRNA اوليه سه ناحيه اگزوني به طولهاي  20 ، 30 و 40 نوكلئوتيد حضور دارند. اگر طول اينترونها همگي يكسان و به طول 15 نوكلئوتيد باشد، بخش رمز گردان ژن اين مولكول mRNA داراي چند نوكلئوتيد است؟

1)120                   2)135                   3)240                         4)270

9-مونومرهاي فعال كننده ي توالي افزاينده  و مونومرهاي مهار كننده اپراتور بترتيب توسط كدام  پيوند ها به هم متصل مي شوند؟

1)پپتيدي پپتيدي                                      2)پپتيدي فسفودي استر

3)فسفو دي استر پپتيدي                         4)فسفو دي استر فسفودي استر

10-در هنگام ترجمه يك مولكول mRNA  زماني كه tRNA  چهارم جايگاه P را ترك              مي كند.........................

1)4 پيوند پپتيدي برقرار شده است.                              

2)4 آمينو اسيد به tRNA  واقع در جايگاه A متصل است.

3)ضمن جابجائي ريبوزوم كدون 5 وارد جايگاه A مي شود.

4)tRNA  پنجم وارد جايگاه A مي شود.

11-در mRNA بالغ يوكاريوتي فقط قسمتي از رونوشت...............................

1)اگزونها حفظ مي شود.                               2)اينترونها ترجمه نمي شود.

3)اگزونها ترجمه نمي شوند.                         4)اينترونها حذف مي شوند.

12-تنوع محصول كدام RNA پليمراز كمتر است؟

1)RNA  پليمراز پروكاريوتي  2)RNA  پليمراز 1      3)RNA  پليمراز 2     4)RNA پليمراز 3 

13-كداميك از موارد زير در يك سلول يافت مي شود؟

1)توالي افزاينده اپران                                  2)DNA  حلقوي  mRNA  چند ژني

3)عامل رونويسي اپران                               4)پلازميد پروتئين فعال كننده

14- كداميك از موارد زير مختص سلولهاي يوكاريوتي است؟

1)mRNA  تك ژني           2)توالي اينترون        3)عوامل رونويسي     4)توالي اپراتور

15- در كداميك از كروموزومهاي انسان ، احتمال وقوع جهش بيشتر است؟

1)كروموزوم 21             2)كروموزوم 5           3)كروموزوم 1           4)كروموزوم X,Y

16- اگر در هنگام سنتز يك رشته پلي پپتيد 49 مولكول آب آزاد شود منطقه ي رمز گردان مربوط به اين رشته ي پلي پپتيد داراي چند نوكلئوتيد است:

1) 150                     2) 153                  3) 300                      4)306

17- چنانچه يك باز آدنين دار به ابتدای توالي زير وارد شود چه تاثيري بر ترجمه خواهد گذاشت؟    

                                                                                                                                                                                                                                                           A

    CGA-UCG-GAA-CCA-GGU-GAU-AAG-CAU                                                                 

1)پروتئيني ساخته نخواهد شد.             2) طول پروتئين بيش از حد معمول خواهد شد.

 

3) طول پروتئين كمتر از حد معمول خواهد شد.       4) جهش بي تاثير خواهد بود.

** با فرض اينكه رشته زير مربوط به توالي بخشي از DNA باكتري اشريشيا كلي باشد به سوالات ۱۸و۱۹ پاسخ دهيد:

TTCTACATGCGGAGCGAATGAACTAGC                                              

 

18- اگر از رشته مورد نظر رونويسي و ترجمه صورت گيرد آخرين كدوني كه در جايگاه P ريبوزوم قرار مي گيرد كدامست؟

 

1) UGA                     2)ACU                  3)CUU                      4)AUG

19- با فرض اينكه از رشته مكمل فوق رونويسي و ترجمه صورت گيرد ريبوزوم چند بار بر روي mRNA   جابجا مي شود؟

1)3                     2)4                       3)5                          4)6

20- ژن رمز گردان فعال كننده ي ژني كه محصولش RNA ريبوزومي است توسط كدام رونويسي مي شود؟

1) RNA پليمراز 1      2) RNA پليمراز 2      3) RNA پليمراز 3      4) RNA  پليمراز پروكاريوتي

21- تزريق  مقدار مناسب و مداوم از كدام يك به بيماران مبتلا به آلكاپتونوريا باعث رفع علائم بيماري در آنها مي شود؟

1) هموجنتسيك اسيد                2)ژن آنزيم تجزيه كننده ي هموجنتسيك اسيد

3) آنزيم تجزيه كننده ي هموجنتسيك اسيد     4)ژن آنزيم توليد كننده ي هموجنتسيك اسيد

22- اگر قرار باشد آزمايش هاي بيدل و تيتوم روي جاندار ديگري شبيه سازي شود ، و ميزان موفقيت آنزيم تغيير نكند ، كدام جاندار مناسب تر است؟

1) مگس سركه              2) اشريشيا كلي         3) نخود فرنگي           4) قورباغه

23- كدام دو توالي زير قطعا در tRNA  آغاز گر وجود دارد؟

1)CCA-AUG           2) ACC-UAC           3) UAC- CCA               4) AUG – ACC


موضوعات مرتبط: زیست بیش دانشگاهی(تست)

تاريخ : چهارشنبه هفتم اسفند 1387 | 12:4 | نویسنده : زبردستی |
Bacteria

موضوعات مرتبط: زیست 1

تاريخ : سه شنبه ششم اسفند 1387 | 12:4 | نویسنده : زبردستی |

 

موضوعات مرتبط: زیست 1

تاريخ : سه شنبه ششم اسفند 1387 | 12:1 | نویسنده : زبردستی |
 
ژنتیک مولکولی :

ژنتیک و زیست شناسی مولکولی دو موضوع کاملا مرتبط بهم هستند و اگر چه تفاوتهایی بین آنها موجود است، ولی بهتر است که آنها را در یک قالب مطرح کرد. به این دلیل اصطلاح ژنتیک مولکولی امروزه اغلب برای تشریح شاخه‌ای از زیست شناسی بکار می‌رود که مربوط به مطالعه همه جنبه‌های یک ژن است.



[تصویر: 34npj4y.jpg]




دید کلی
ماهیت مولکولی ماده ژنتیکی چیست؟ چطور اطلاعات ژنتیکی از یک نسل به نسل بعد با صحت بالا انتقال می‌یابد؟ تغییرات نادر در ماده ژنتیکی که ماده خام تکامل می‌باشد، چگونه ایجاد می‌شوند؟ چطور اطلاعات ژنتیکی نهایتا به شکل توالیهای اسید آمینه‌ای مولکولهای پروتئینی متنوع موجود در یک سلول زنده ، بیان می‌شود؟ و ... . واحد پایه اطلاعات در سیستمهای زنده ، ژن می‌باشد.

از نظر بیوشیمیایی یک ژن به صورت قطعه‌ای از DNA تعریف می‌شود که اطلاعات مورد نیاز برای ایجاد یک محصول دارای فعالیت بیولوژیک راکد می‌کند. محصول نهایی معمولا یک پروتئین است. ممکن است محصول ژنی وظیفه‌ای یکی از انواع RNA باشد. ذخیره ، حفظ و متابولیزم این واحدهای اطلاعاتی موضوعات بحث را در ژنتیک مولکولی تشکیل می‌دهند. پیشرفتهای اخیر در ژنتیک مولکولی ، منجر به مطرح شدن سه فرآیند اصلی در استفاده از اطلاعات ژنتیکی شده است.



اولین فرآیند ، همانند سازی DNA یا نسخه برداری از DNA مادری و تولید مولکولهای DNA با توالیهای نوکلئوتیدی یکسان می‌باشد.


دومین فرآیند سنتز RNA از روی DNA است، که طی قسمتهایی از پیام ژنتیکی کد شده در DNA دقیقا به صورت RNA ، نسخه برداری می‌شود.


سومین فرآیند ، ترجمه می‌باشد که به موجب آن پیام ژنتیکی کد شده در RNA پیک بر روی ریبوزومها به پلی‌پپتیدی با توالی مشخص از اسیدهای آمینه ترجمه می‌شود.


[تصویر: 140clcp.jpg]



وقایع مهم در ژنتیک مولکولی تا سال 1944
شروع ژنتیک توسط گرگور مندل و با مقاله‌ای بود که وی در سال 1866 در مجموعه مقالات انجمن علوم طبیعی در مورد نخود فرنگی ، به چاپ رساند.
تا سال 1900 طول کشید تا سایر زیست شناسان مانند هوگو ، کورنس و شرماک اهمیت کار مندل را درک کنند و این علم پس از رکورد طولانی توالی دوباره یافت.
در سال 1903 ، ساتن پیشنهاد کرد که ژنها روی کروموزومها قرار دارند.
در سال 1909 ، یوهانس پیشنهاد کرد که عوامل مندلی ژن نامیده شدند.
در سال 1910 ، مورگان آزمایشهای زیادی بر روی مگس سرکه انجام داد.
در سال 1927 ، مولر کشف کرد که اشعه ایکس ایجاد موتاسیون (جهش) در مگس سرکه می‌نماید.
در سال 1941 ، بیدل و تاتوم پیشنهاد کردند که هر ژن فعالیت یک آنزیم را کنترل می‌کند.
در سال 1944 ، کتاب زندگی چیست توسط یک فیزیکدان به نام شرودینگر انتشار یافت.
کشف ساختمان DNA
شناخت امروزی ما در مورد مسیرهای اطلاعاتی از همگرایی یافته‌های ژنتیکی ، فیزیکی و شیمیایی در بیوشیمی امروزی حاصل شده است. لین شناخت در کشف ساختمان دو رشته مارپیچی DNA ، توسط جیمز واتسون و فرانسیس کریک در سال 1953 خلاصه گردید. فرضیه ژنتیکی ، مفهوم کد نمودن توسط ژنها را مشخص نمود. با استفاده از روشهای فیزیکی ، تعیین ساختمان مولکولی DNA بوسیله آزمایش انکسار اشعه ایکس ممکن گردید. شیمی نیز ترکیب DNA را آشکار نمود. ساختمان مارپیچی دو رشته‌ای DNA ، چگونگی نسخه برداری آن را نشان داد، نحوه تولید RNA و سنتز پروتئین از روی آن را شفاف کرد.



[تصویر: 9pyge8.jpg]


ژنها و کروموزومها
ژنها قطعاتی از یک کروموزوم هستند که اطلاعات مورد نیاز برای یک مولکول DNA یا یک پلی پپتید را دارند. علاوه بر ژنها ، انواع مختلفی از توالیهای مختلف تنظیمی در روی کروموزومها وجود دارد که در همانند سازی ، رونویسی و ... شرکت دارند. کروموزومهای یوکاریوتی دارای دو توالی مهم تکراری DNA می‌باشند که عمل اختصاصی را انجام می‌دهند؛ سانترومرها که نقاط اتصالی برای دوک تقسیم هستند و تلومرها که در دو انتهای کروموزوم وجود دارند. کروماتین در یوکاریوتها به صورت واحدهای نوکلئوزومی قرار دارد.

متابولیزم DNA
سلامت DNA بیشترین اهمیت را برای سلول دارد که آن را می‌توان از پیچیدگی و کثرت سیستمهای آنزیمی شرکت کننده در همانند سازی ، ترمیم و نوترکیبی DNA ، دریافت. همانند سازی DNA با صحت بسیار بالا و در یک دوره زمانی مشخص در طی چرخه سلولی به انجام می رسد. همانند سازی نیمه حفاظتی است، بطوری که هر رشته آن به عنوان قالبی برای تولید رشته جدید DNA مورد استفاده قرار می‌گیرد. سلولها دارای سیستمهای متعددی برای ترمیم DNA هستند. توالیهای DNA در طی واکنشهای نوترکیبی ، در فرآیندهایی که شدیدا هماهنگ با همانند سازی یا ترمیم DNA هستند، نو آرایی می‌شوند.

متابولیزم RNA
رونویسی توسط آنزیم RNA پلیمراز وابسته به DNA کاتالیز می‌شود. رونویسی در چندین فاز ، شامل اتصال RNA پلیمراز به یک جایگاه DNA به نام پروموتور ، شروع سنتز رونویسی ، طویل سازی و خاتمه ، روی می‌دهد. سه نوع RNA ساخته می‌شود؛ RNA پیک که برای ساختن پلی پپتیدها مورد استفاده قرار می‌گیرد. RNA ناقل که در انتقال اسیدهای آمینه بر روی ریبوزومها برای پروتئین سازی ، شرکت دارند و RNA ریبوزومی که در ساختار ریبوزوم شرکت دارند. این RNA ها به صورت پیش ساز ساخته می‌شوند که طی فرآیندهای آنزیمی بالغ می‌شوند.

متابولیزم پروتئین
پروتئینها در یک کمپلکس RNA پروتئینی به نام ریبوزوم ، با یک توالی اسید آمینه‌های خاص در طی ترجمه اطلاعات کد شده در RNA پیک ، سنتز می‌گردند. اسیدهای آمینه‌ای که توسط کدونهای RNA پیک مشخص می‌گردند، از کلمات سه حرفی نوکلئوتیدی تشکیل شده‌اند. برای ترجمه نیاز به مولکولهای RNA ناقل می‌باشد که با شناسایی کدونها ، اسیدهای آمینه را در موقعیتهای متوالی مناسب خود در داخل زنجیر پلی پپتیدی قرار می‌دهند. بعد از سنتز بسیاری از پروتئینها به موقعیتهای خاص خود در داخل سلول هدایت می‌شوند.



[تصویر: 2s6rmkw.gif]


تنظیم بیان ژن
بیان ژنها توسط فرآیندهایی تنظیم می‌شود که بر روی سرعت تولید و تخریب محصولات ژنی اثر می‌گذارند. بیشتر این تنظیم در سطح شروع رونویسی و بواسطه پروتئینهای تنظیمی رخ می‌دهد که رونویسی را از پروموتورهای اختصاصی مهار یا تحریک می‌کنند. اثر مهارکننده ها را تنظیم منفی و فعال شدن را تنظیم مثبت گویند. پروتئینهای تنظیمی ، پروتئینهای اتصالی DNA هستند که توالیهای اختصاصی از DNA را شناسایی می‌کنند. هورمونها بر روی تنظیم بیان ژن تأثیر دارند. موجودات یوکاریوت و پروکاریوت دارای مکانیزمهای متفاوتی برای تنظیم بیان ژنهای خود دارند.

فناوری DNA نوترکیبی
با استفاده از فناوری DNA نو ترکیبی مطالعه ساختمان و عملکرد ژن بسیار آسان شده است. جداسازی یک ژن از یک کروموزوم بزرگ نیاز دارد به، روشهایی برای برش و دوختن قطعات DNA ، وجود ناقلین کوچک که قادر به تکثیر خود بوده و ژنها در داخل آنها قرار داده می‌شوند، روشهایی برای ارائه ناقل حاوی DNA خارجی به سلولی که در آن بتواند تکثیر یافته و کلنیهایی را ایجاد کند و روشهایی برای شناسایی سلولهای حاوی DNA مورد نظر. پیشرفتهای حاصل در این فناوری ، در حال متحول نمودن بسیاری از دیدگاههای پزشکی ، کشاورزی و سایر صنایع می‌باشد

موضوعات مرتبط: زیست پیش

تاريخ : سه شنبه ششم اسفند 1387 | 11:54 | نویسنده : زبردستی |
تاريخ : شنبه سوم اسفند 1387 | 22:43 | نویسنده : زبردستی |
 

نگاه کلی

ریشه اندامی از گیاه است که معمولا در خاک قرار دارد و موجب ثابت نگاه داشتن ساقه و اجزای آن می‌گردد. عمل مهم دیگر ریشه جذب آب و مواد غذایی اولیه نظیر آب و املاح مختلف از زمین بوده و همچنین ممکن است مواد غذایی مختلف درخود ذخیره کند. علاوه بر این اعمال اصلی ، ریشه نظیر ساقه رشد می‌کند و محل عبور جریانهای شیره‌های غذایی است (شیره خام و شیره پرورده). با توجه به اعمال مشابه و غیرمشابهی که ریشه با ساقه دارد سبب می‌شود که در مواردی ساختمان متفاوتی نیز با آن داشته باشد.



تصویر

اجزای مختلف ریشه

  • کلاهک ریشه: قسمت کاملا انتهایی ریشه که کلاهک ریشه نامیده می‌شود. یاخته‌های کاملا راسی و خارجی کلاهک به تدریج و بطور دایم در اثر تماس با خاک و عوامل محیط زیست به صورت پوسته‌های نازکی می‌افتد و درعین حال بطور دائم نیز بوسیله یاخته‌های مریستمی راس ریشه ساخته شده به آن اضافه می‌شود.

  • ناحیه نمو ریشه یا منطقه مریستمی: که در مقطع طولی آن را به نام مریستم نزدیک انتهایی ریشه‌ها می‌نامند. سلولهای حاصل از این منطقه ضمن تمایز یابی سلولهای مختلف ریشه را بوجود می‌آورند.

  • منطقه طویل شدن: یاخته‌های حاصل از تقسیم یاخته‌های مریستم ریشه در این ناحیه طویل می‌شوند.

  • منطقه تارهای کشنده: منطقه تارهای کشنده ، که بیشتر مواد غذایی از این منطقه جذب گیاه اولیه می‌شود. ضمنا یاخته‌های داخلی همین منطقه تغییر شکل و ساختمان داده و موجب تشکیل بافتهای مختلف در ریشه می‌گردد. لذا این منطقه را ناحیه تمایزیابی نیز می‌نامند.

ساختمان داخلی یک ریشه جوان از خارج به داخل در مقطع عرضی

اپیدرم یا بشره

اپیدرم یا بشره یک ردیف یاخته‌هایی است که از پروتودرم منشا می‌گیرد و تشکیل تارهای کشنده را نیز در بعضی از نقاط می‌دهد. در مواردی که محیط مرطوب باشد، تشکیل تار کشنده بیشتر و بهتر صورت می‌گیرد. تارهای کشنده یاخته‌های اپیدرمی هستند که در قسمتهای جانبی ریشه تشکیل می‌گردد. دیواره یاخته‌های تارهای کشنده نازک بوده و معمولا سلولز آن با مواد پکتیکی آغشته شده است. پروتوپلاسم یاخته‌های تار کشنده سرشار از آب بوده و دارای واکوئل بزرگ است. هسته معمولا در انتهای قسمت تار یا مویی یاخته می‌باشد.



تصویر

کورتکس

داخلی‌ترین لایه کورتکس ، آندودرم نامیده می‌شود، که معمولا از مشخصات بارز ریشه‌ها است. آندودرم معمولا جدار نازک داشته به جز در قسمت دیواره‌های شعاعی و عرضی یاخته که ضخیم شده و از نوع کوتینی یا سوبرین درآمده و اصطلاحا نوار کاسپارین نامیده می‌شود که رشته یا نواری است که کوتین یا سوبرین که دور تا دور یاخته‌های آندودرمی را در جهت دیواره‌های شعاعی و عرضی یاخته فرا گرفته است.

دایره محیطیه

در مراحل اولیه از تکامل ریشه یک لایه مخصوص از یاخته‌های پارانشیمی از تغییر شکل لایه خارجی لایه زاینده استوانه مرکزی بوجود می‌آید. این لایه (دایره محیطیه) نسبتا به حالت غیر فعال مریستمی باقی می‌ماند. تا هنگام فعالیت ثانویه ریشه از آن پس ریشه‌های جانبی از این منطقه منشا می‌گیرند. یاخته‌های خارجی آن منتهی به تشکیل لایه زاینده آوندی می‌گردد و قسمتهای دیگر موجب تشکیل لایه زاینده چوب پنبه می‌شود.

استوانه مرکزی

این ناحیه از قسمتهای داخلی حاصل از پروکامبیوم تشکیل می‌شود. در این حالت هیچگونه پارانشیم داخلی و مغزی در ریشه گیاهان دولپه دیده نمی‌شود. فقط در مواردی ممکن است در تک لپه‌ایها دیده شود (پارانشیم مغزی). بعضی اوقات مجموعه دایره محیطیه و استوانه آوندی را که مجموعا از پروکامبیوم منشا می‌گیرند، یک واحد به نام استل می‌نامند. در ریشه‌های اولیه معمولا حبابهای اولیه به صورت توده مرکزی که با چند بازوی منشعب دیده می‌شود، تشکیل و ظاهر می‌گردد که بین هر دو انشعاب آوند چوبی را یک دسته آوند آبکشی اشغال می‌کند. بین این دو دسته آوند (چوبی و آبکشی) یک یا چند لایه سلول به نام لایه زاینده چوب آبکشی تشکیل می‌گردد. در گیاهانی که ساختمان پسین ریشه دیده نمی‌شود. یاخته‌های باقی مانده بین چوب و آبکش به تدریج اسکلرانشیمی می‌گردد.

به هر حال در بسیاری از ریشه گیاهان دولپه ، پارانشیم مغزی دیده نمی‌شود. اما بیشتر تک لپه‌ایها و بعضی
گیاهان علفی دولپه که دستجات آوند چوبی در مرکز به هم می‌رسند به صورت پارانشیمی باقی می‌ماند و یک مغز پارانشیمی کاذبی تشکیل می‌دهند که در واقع با پارانشیم مغزی که در ساقه‌ها دیده می‌شود، تفاوت کلی دارد. زیرا که پارانشیم مغزی در ساقه از مریستم زمینه‌ای منشا می‌گیرد. حال آن که اگر پارانشیم مغزی در ریشه‌ای دیده شود، از پروکامبیوم آوندی منشا گرفته است. بطور کلی آوند چوبی اولیه‌ای که در ساقه دیده می‌شود در ریشه‌ها نیز دیده می‌شود. با این تفاوت که آوندهای چوبی مارپیچی و حلقوی در ریشه‌ها نسبتا نادرند. در حالی که در ساقه بیشتر دیده می‌شوند. ولی آوندهای آبکش اولیه در ساقه و ریشه هر دو همانند و یکسان است و هر دو دارای جسمهای غربالی یاخته‌های همراه و پارانشیم می‌باشند.



تصویر

منشا ریشه‌های جانبی

ریشه‌های جانبی و یا انشعابات ریشه بطور کلی در بازدانگان و نهاندانگان از یاخته‌های دایره محیطیه منشا می‌گیرند. غالبا انشعابات ریشه از نقطه مقابل دستجات آوند چوبی اولیه منشا می‌گیرد. بنابراین می‌توان گفت که به ازای آوندهای چوبی اولیه انشعابات ریشه یا ریشه جانبی خواهیم داشت. مثلا در چغندر که دو دسته آوند چوبی دارد، دو ردیف عمومی انشعاب ریشه‌ای مشاهده می‌شود. سلولهای حاصل از فعالیت یاخته‌ای ، مولد ریشه فرعی که از پریسیکل منشا می‌گیرد، در بافت کورتکس نفوذ کرده تا به بشره می‌رسد. در ضمن عبور سرانجام کشیدگی ، پارگی بافتهای مسیر خود را که در اثر ریشه فرعی و فشار مکانیکی می‌باشد، می‌شود


تاريخ : پنجشنبه یکم اسفند 1387 | 12:33 | نویسنده : زبردستی |
.: Weblog Themes By VatanSkin :.